ID: 1183212344_1183212349

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1183212344 1183212349
Species Human (GRCh38) Human (GRCh38)
Location 22:36458648-36458670 22:36458677-36458699
Sequence CCTCTCCTGCTCCAAACTTGCTA TTCCCTATCTCAACATCATAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 199} {0: 1, 1: 0, 2: 1, 3: 8, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!