ID: 1183225780_1183225793

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1183225780 1183225793
Species Human (GRCh38) Human (GRCh38)
Location 22:36548996-36549018 22:36549036-36549058
Sequence CCCTCGTCCCTGTTGATCTTCAC GGAAAGGCTTGGGAGATGCCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 32, 4: 319}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!