ID: 1183248975_1183248980

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1183248975 1183248980
Species Human (GRCh38) Human (GRCh38)
Location 22:36714857-36714879 22:36714906-36714928
Sequence CCTCAGTATAGAATTTATGAATT TACACGAGAATGCTCAAGAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 6, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!