ID: 1183257335_1183257339

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1183257335 1183257339
Species Human (GRCh38) Human (GRCh38)
Location 22:36770968-36770990 22:36770987-36771009
Sequence CCCGCCTGCTTCTCCTTTTTCTT TCTTAGTACTACCCTAGCAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 22, 3: 278, 4: 2138} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!