ID: 1183290972_1183290978

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1183290972 1183290978
Species Human (GRCh38) Human (GRCh38)
Location 22:37001961-37001983 22:37001981-37002003
Sequence CCGTCATCCGTCCCCTGGCATGG TGGCTGAGCCCCCTCTCCCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 156} {0: 1, 1: 5, 2: 6, 3: 26, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!