ID: 1183291432_1183291444

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1183291432 1183291444
Species Human (GRCh38) Human (GRCh38)
Location 22:37004127-37004149 22:37004167-37004189
Sequence CCGCCCCTGATCAGAGGTTCCTA TCTGGCACTGCCCAGACCCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 110} {0: 1, 1: 0, 2: 5, 3: 27, 4: 302}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!