ID: 1183292468_1183292475

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1183292468 1183292475
Species Human (GRCh38) Human (GRCh38)
Location 22:37011127-37011149 22:37011162-37011184
Sequence CCGCAGAGGTAGGCAGCCAAGGC GGTGACTCCCTTGCGGCACGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 72, 4: 540} {0: 1, 1: 0, 2: 0, 3: 3, 4: 41}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!