ID: 1183292468_1183292478

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1183292468 1183292478
Species Human (GRCh38) Human (GRCh38)
Location 22:37011127-37011149 22:37011172-37011194
Sequence CCGCAGAGGTAGGCAGCCAAGGC TTGCGGCACGTGGCAATGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 72, 4: 540} {0: 1, 1: 0, 2: 0, 3: 2, 4: 51}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!