ID: 1183306588_1183306591

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1183306588 1183306591
Species Human (GRCh38) Human (GRCh38)
Location 22:37086181-37086203 22:37086202-37086224
Sequence CCATCCTCAATTTGGGCAAAAAA AAGGTGAGCAGTGAGCCCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 273} {0: 1, 1: 0, 2: 3, 3: 43, 4: 301}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!