ID: 1183328386_1183328393

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1183328386 1183328393
Species Human (GRCh38) Human (GRCh38)
Location 22:37206539-37206561 22:37206580-37206602
Sequence CCAGGCCCCTACAGGTAGCTGAT CTCCCCAGTGGAAGCCTCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 121} {0: 1, 1: 0, 2: 4, 3: 15, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!