ID: 1183359121_1183359128

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1183359121 1183359128
Species Human (GRCh38) Human (GRCh38)
Location 22:37374310-37374332 22:37374329-37374351
Sequence CCATGCCAAAGAGGCAGCCCAGG CAGGATGGTCATGATGTAGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 35, 4: 288} {0: 2, 1: 0, 2: 2, 3: 9, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!