ID: 1183381536_1183381545

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1183381536 1183381545
Species Human (GRCh38) Human (GRCh38)
Location 22:37492713-37492735 22:37492759-37492781
Sequence CCAGGCACTCAGGCAACAGCACC TAGCGGCCGCACCAAACTGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 280} {0: 1, 1: 0, 2: 0, 3: 0, 4: 17}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!