ID: 1183409551_1183409574

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1183409551 1183409574
Species Human (GRCh38) Human (GRCh38)
Location 22:37646913-37646935 22:37646961-37646983
Sequence CCCGCACGCTGTGGCAGGTGCCT TTGGGGGGGAGGGGGTGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 244} {0: 1, 1: 0, 2: 17, 3: 208, 4: 1629}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!