ID: 1183411116_1183411130

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1183411116 1183411130
Species Human (GRCh38) Human (GRCh38)
Location 22:37655515-37655537 22:37655553-37655575
Sequence CCCCAGGTCCAGCCTCCCCCAGC AACCCTGCACAGGTGGACCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 94, 4: 664} {0: 1, 1: 0, 2: 1, 3: 11, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!