ID: 1183431000_1183431003

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1183431000 1183431003
Species Human (GRCh38) Human (GRCh38)
Location 22:37765711-37765733 22:37765729-37765751
Sequence CCAGCAGGTGATGGAGGAGCTGC GCTGCAGCGGCACCACGAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 41, 4: 370} {0: 1, 1: 0, 2: 2, 3: 23, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!