ID: 1183439194_1183439202

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1183439194 1183439202
Species Human (GRCh38) Human (GRCh38)
Location 22:37813606-37813628 22:37813632-37813654
Sequence CCAGGTGGGGCGACGCCTGGGTC CCTCAGCCTCCGCCTGGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 126} {0: 1, 1: 0, 2: 8, 3: 21, 4: 363}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!