ID: 1183439194_1183439207

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1183439194 1183439207
Species Human (GRCh38) Human (GRCh38)
Location 22:37813606-37813628 22:37813650-37813672
Sequence CCAGGTGGGGCGACGCCTGGGTC GAAGGAAGTGAGGCTTAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 126} {0: 2, 1: 3, 2: 73, 3: 561, 4: 2808}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!