ID: 1183444491_1183444501

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1183444491 1183444501
Species Human (GRCh38) Human (GRCh38)
Location 22:37844157-37844179 22:37844206-37844228
Sequence CCGGCGCCACCGCGCACTCGCCC CTCGTCGTCCGCGTCCCCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 270} {0: 1, 1: 0, 2: 0, 3: 8, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!