ID: 1183455819_1183455826

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1183455819 1183455826
Species Human (GRCh38) Human (GRCh38)
Location 22:37922513-37922535 22:37922532-37922554
Sequence CCCCTCTCCATCTGTGCCATTGT TTGTGTGCTGTGCTGTGTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 354} {0: 1, 1: 0, 2: 8, 3: 50, 4: 380}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!