ID: 1183457999_1183458007

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1183457999 1183458007
Species Human (GRCh38) Human (GRCh38)
Location 22:37933148-37933170 22:37933162-37933184
Sequence CCTGGGGCCTGGTGACACGGAGG ACACGGAGGAGTGGGGGAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 259} {0: 1, 1: 0, 2: 2, 3: 40, 4: 368}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!