ID: 1183457999_1183458009

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1183457999 1183458009
Species Human (GRCh38) Human (GRCh38)
Location 22:37933148-37933170 22:37933190-37933212
Sequence CCTGGGGCCTGGTGACACGGAGG AAAACCCCAGTAGGATGCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 259} {0: 1, 1: 0, 2: 1, 3: 9, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!