ID: 1183466733_1183466743

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1183466733 1183466743
Species Human (GRCh38) Human (GRCh38)
Location 22:37983864-37983886 22:37983910-37983932
Sequence CCCACCTGGATGGAAGGAGGGCG CCCCGAGGGCGGCCCGAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 147} {0: 1, 1: 0, 2: 0, 3: 8, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!