ID: 1183467857_1183467869

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1183467857 1183467869
Species Human (GRCh38) Human (GRCh38)
Location 22:37988888-37988910 22:37988920-37988942
Sequence CCGGAGAGCTTTGGGGTGTGGCA CTATGCACTGGGAAGGTGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 29, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!