ID: 1183482116_1183482126

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1183482116 1183482126
Species Human (GRCh38) Human (GRCh38)
Location 22:38070830-38070852 22:38070877-38070899
Sequence CCCGACAGATGGGCTTGTCAAGA CTGAGCTATACAAAGGTGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 101} {0: 1, 1: 0, 2: 1, 3: 8, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!