ID: 1183489106_1183489112

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1183489106 1183489112
Species Human (GRCh38) Human (GRCh38)
Location 22:38107366-38107388 22:38107402-38107424
Sequence CCGGGGGGCTGGGCTGTGTTGGG GCTGCTGGATCGACAGAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 62, 4: 528} {0: 1, 1: 0, 2: 1, 3: 12, 4: 212}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
13 22:38107366-38107388 CCGGGGGGCTGGGCTGTGTTGGG - 22:38107402-38107424 GCTGCTGGATCGACAGAGCCAGG +