ID: 1183507129_1183507137

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1183507129 1183507137
Species Human (GRCh38) Human (GRCh38)
Location 22:38215397-38215419 22:38215446-38215468
Sequence CCCAGTTCACGGATGGGGAAACA GTTGTGTTGGGACCAAAACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 15, 3: 185, 4: 1462} {0: 1, 1: 0, 2: 1, 3: 1, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!