ID: 1183516516_1183516520

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1183516516 1183516520
Species Human (GRCh38) Human (GRCh38)
Location 22:38270022-38270044 22:38270039-38270061
Sequence CCCTGTTGACATCAGGATCAAGT TCAAGTTCAAACTCCTTGGCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 20, 4: 168} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!