ID: 1183522340_1183522345

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1183522340 1183522345
Species Human (GRCh38) Human (GRCh38)
Location 22:38302860-38302882 22:38302885-38302907
Sequence CCATCTGGTCGGCCAAGAGCAGC CGTCTTGAGGCTGAATTTGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 102} {0: 1, 1: 0, 2: 1, 3: 6, 4: 74}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
2 22:38302860-38302882 CCATCTGGTCGGCCAAGAGCAGC - 22:38302885-38302907 CGTCTTGAGGCTGAATTTGCGGG +