ID: 1183522341_1183522347

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1183522341 1183522347
Species Human (GRCh38) Human (GRCh38)
Location 22:38302872-38302894 22:38302911-38302933
Sequence CCAAGAGCAGCACCGTCTTGAGG AGAAGTTGAACAGGTCCTCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 108} {0: 1, 1: 0, 2: 2, 3: 5, 4: 76}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
16 22:38302872-38302894 CCAAGAGCAGCACCGTCTTGAGG - 22:38302911-38302933 AGAAGTTGAACAGGTCCTCGAGG +