ID: 1183522343_1183522346

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1183522343 1183522346
Species Human (GRCh38) Human (GRCh38)
Location 22:38302884-38302906 22:38302902-38302924
Sequence CCGTCTTGAGGCTGAATTTGCGG TGCGGGAACAGAAGTTGAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 67} {0: 1, 1: 0, 2: 0, 3: 8, 4: 121}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
-5 22:38302884-38302906 CCGTCTTGAGGCTGAATTTGCGG - 22:38302902-38302924 TGCGGGAACAGAAGTTGAACAGG +