ID: 1183554657_1183554660

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1183554657 1183554660
Species Human (GRCh38) Human (GRCh38)
Location 22:38515856-38515878 22:38515873-38515895
Sequence CCCAAATTCTTTCTTGGGTGAGG GTGAGGTCCAAGAACTCTCTCGG
Strand - +
Off-target summary {0: 1, 1: 9, 2: 99, 3: 375, 4: 768} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!