ID: 1183583241_1183583244

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1183583241 1183583244
Species Human (GRCh38) Human (GRCh38)
Location 22:38737933-38737955 22:38737955-38737977
Sequence CCTGGTGTCCTTTTCCAGGAAGC CTTCCCTCATGCTGCCCTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 233} {0: 1, 1: 1, 2: 1, 3: 29, 4: 308}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!