ID: 1183607087_1183607096

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1183607087 1183607096
Species Human (GRCh38) Human (GRCh38)
Location 22:38872171-38872193 22:38872218-38872240
Sequence CCCACTGCAGACAGCTCCATCTT ATACTCCCTGCGCCCGCGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 201} {0: 1, 1: 0, 2: 0, 3: 1, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!