ID: 1183613762_1183613772

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1183613762 1183613772
Species Human (GRCh38) Human (GRCh38)
Location 22:38928891-38928913 22:38928940-38928962
Sequence CCAGGCTGGTCTTGAACTCTTGA TTCCAAAGTGCTGGGATTACAGG
Strand - +
Off-target summary {0: 2250, 1: 56705, 2: 131052, 3: 182328, 4: 198099} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!