ID: 1183639226_1183639229

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1183639226 1183639229
Species Human (GRCh38) Human (GRCh38)
Location 22:39083170-39083192 22:39083186-39083208
Sequence CCTTTATAATTGTGGTTTTGTAA TTTGTAAGGACAGGTATTTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 418} {0: 1, 1: 0, 2: 1, 3: 13, 4: 231}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!