ID: 1183639386_1183639403

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1183639386 1183639403
Species Human (GRCh38) Human (GRCh38)
Location 22:39083894-39083916 22:39083929-39083951
Sequence CCAGCCACCCGCATCCAGGCAGG CAGGGACACCCATGGGCAGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 35, 4: 342} {0: 1, 1: 0, 2: 5, 3: 34, 4: 305}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!