ID: 1183649445_1183649455

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1183649445 1183649455
Species Human (GRCh38) Human (GRCh38)
Location 22:39145655-39145677 22:39145668-39145690
Sequence CCCCCGCCGGCCGCGCGCACGCA CGCGCACGCACGCACGGGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 11, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!