ID: 1183650010_1183650014

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1183650010 1183650014
Species Human (GRCh38) Human (GRCh38)
Location 22:39148446-39148468 22:39148464-39148486
Sequence CCTGGTGCGAAGCGAGAGAGGCA AGGCAGGGGTGTGCGCGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 90} {0: 1, 1: 0, 2: 1, 3: 23, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!