ID: 1183658671_1183658678

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1183658671 1183658678
Species Human (GRCh38) Human (GRCh38)
Location 22:39205839-39205861 22:39205857-39205879
Sequence CCCGGGACACCCCCCAGTCACCA CACCACCCACAGCCTCCCAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 81, 4: 1062}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!