ID: 1183661340_1183661354

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1183661340 1183661354
Species Human (GRCh38) Human (GRCh38)
Location 22:39223295-39223317 22:39223336-39223358
Sequence CCCTCCCCACATCCAGCCCACCC CTTCCTCTATGGAGACCCTCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 11, 3: 178, 4: 1318} {0: 1, 1: 0, 2: 3, 3: 13, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!