ID: 1183665681_1183665691

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1183665681 1183665691
Species Human (GRCh38) Human (GRCh38)
Location 22:39244538-39244560 22:39244564-39244586
Sequence CCCGCCCGGGCCGGGTAGGGGGG GAGCGTGTGCGCCCTGGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 371} {0: 1, 1: 0, 2: 0, 3: 9, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!