ID: 1183665683_1183665689

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1183665683 1183665689
Species Human (GRCh38) Human (GRCh38)
Location 22:39244539-39244561 22:39244558-39244580
Sequence CCGCCCGGGCCGGGTAGGGGGGC GGGCGGGAGCGTGTGCGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 252} {0: 1, 1: 0, 2: 1, 3: 25, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!