ID: 1183665683_1183665692

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1183665683 1183665692
Species Human (GRCh38) Human (GRCh38)
Location 22:39244539-39244561 22:39244565-39244587
Sequence CCGCCCGGGCCGGGTAGGGGGGC AGCGTGTGCGCCCTGGCGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 252} {0: 1, 1: 0, 2: 0, 3: 7, 4: 63}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!