ID: 1183676309_1183676316

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1183676309 1183676316
Species Human (GRCh38) Human (GRCh38)
Location 22:39300689-39300711 22:39300721-39300743
Sequence CCTGCTGCATTGCAGGAACAGAG GTGTGGCCATGAGGCCTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 271} {0: 1, 1: 0, 2: 5, 3: 42, 4: 414}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!