ID: 1183684398_1183684404

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1183684398 1183684404
Species Human (GRCh38) Human (GRCh38)
Location 22:39353230-39353252 22:39353246-39353268
Sequence CCCCCAAATCATGTAAGCTTCAG GCTTCAGGGCCTCACCAACCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!