ID: 1183702377_1183702387

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1183702377 1183702387
Species Human (GRCh38) Human (GRCh38)
Location 22:39457665-39457687 22:39457687-39457709
Sequence CCCGAGCGTGACCTTAGGGGGCG GGGCGCGGGCGCACTGGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 34} {0: 1, 1: 0, 2: 2, 3: 50, 4: 484}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!