ID: 1183735552_1183735562

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1183735552 1183735562
Species Human (GRCh38) Human (GRCh38)
Location 22:39642973-39642995 22:39642996-39643018
Sequence CCTAGGGAGCCCCTCAGAGCCAG GACAGCCGGGATGAGGGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 40, 4: 361} {0: 1, 1: 0, 2: 2, 3: 36, 4: 304}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!