ID: 1183740236_1183740241

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1183740236 1183740241
Species Human (GRCh38) Human (GRCh38)
Location 22:39664931-39664953 22:39664962-39664984
Sequence CCCCTCCTGGGCGGATGGGGGAA GCACTGTACCGAGAAGCCACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 186} {0: 1, 1: 0, 2: 1, 3: 10, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!