ID: 1183747006_1183747016

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1183747006 1183747016
Species Human (GRCh38) Human (GRCh38)
Location 22:39697852-39697874 22:39697888-39697910
Sequence CCTTCCTGCTTCTGCGAATGAGG GGAGGTGAAGCAACCTCTCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 23, 4: 243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!