ID: 1183758144_1183758150

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1183758144 1183758150
Species Human (GRCh38) Human (GRCh38)
Location 22:39790040-39790062 22:39790073-39790095
Sequence CCAGGAACACCAACAGGTCTAAG CTGAATGTGCAGAAGGAGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 126} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!